x

Image InputX

Upload an image from your computer:
Enter a URL for an image:
 

File UploadX

Upload a file from your computer:
Enter a URL for a file:
 


Copy & paste as input »Terms | Privacy

All files »Recent files
Loading
Supported formats and sample files
Assuming "genetics" is a general topic | Use as a word instead
Life Sciences
Genomics & Molecular Biology
translate a DNA base sequence and find occurrences in the human genome

AAGCTAGCTAGC

find the DNA sequence at given position on a chromosome

chromosome 5, 12.65 million base pairs

analyze a human gene and locate it on a chromosome

scnn1a

get information about a SNP

rs1323042

analyze a protein

myoglobin

analyze a mouse gene

mouse gene scnn1a

locate a DNA sequence relative to a gene

100kbp upstream from mouse gene nampt

analyze a fruit fly gene

fruit fly gene HOX

get a reference sequence for a fruit fly gene

fruit fly gene CRMP sequence

Comparative Genomics

get genome information about an organism

genome of mouseear cress

compare genomic data across organisms

how many chromosomes orangutan vs human vs chimp

compare genes across organisms

homologs of CCR5 gene

Oligonucleotides

calculate the molecular weight of an oligonucleotide

ATTGGGCAAAAA molecular weight

ATTTAGGAGGAGTGATGCAGCGATA molecular weight

compute oligonucleotide melting temperature

melting point GCTCGTAGCTACGT

Biomolecules

get information about a biomolecule

serotonin

ubiquinone

 
Give us your feedback:
 
x

Output Zoom

Zoom in to see an enlarged view of any output.

Start FREE Pro Trial

Learn about all Pro features »
X

Edit this favorite


 
AdvertisementAvoid ads Upgrade to Wolfram|Alpha Pro »
x

CDF Interactivity

Bring Wolfram|Alpha output to life with CDF interactivity.

Start FREE Pro Trial
Learn about all Pro features »