ATTTAGGAGGAGTGATGCAGCGATA molecular weight - Wolfram|Alpha


Image InputX

Upload an image from your computer:
Enter a URL for an image:

File UploadX

Upload a file from your computer:
Enter a URL for a file:

Copy & paste as input »Terms | Privacy

All files »Recent files
Supported formats and sample files
Assuming the input refers to a formula | Use "ATTTAGGAGGAGTGATGCAGCGATA" as a genome sequence instead
oligonucleotide 5' terminal group:
oligonucleotide 3' terminal group:
number of oligonucleotide strands:

Input information:

EnlargeEnable InteractivityDownload as CDF


link to /input/?i=7810.01+daltons&lk=1link to /input/?i=7810.01+daltons&lk=1
EnlargeEnable InteractivityDownload as CDF


link to /input/?i=H2O&lk=1&a=ClashPrefs_*Chemical-link to /input/?i=H2O&lk=1&a=ClashPrefs_*Chemical-link to /input/?i=H2O&lk=1&a=ClashPrefs_*Chemical-
EnlargeEnable InteractivityDownload as CDF

Molecular masses of deoxyribonucleotide monophosphates:

link to /input/?i=331.2+daltons&lk=1link to /input/?i=331.2+daltons&lk=1link to /input/?i=307.2+daltons&lk=1link to /input/?i=307.2+daltons&lk=1link to /input/?i=347.2+daltons&lk=1link to /input/?i=347.2+daltons&lk=1link to /input/?i=322.2+daltons&lk=1link to /input/?i=322.2+daltons&lk=1
EnlargeEnable InteractivityDownload as CDF

Download full output as:

To open this file you need the FREE Wolfram CDF Player or Mathematica 8
Download Wolfram CDF Player Continue downloading file
Give us your feedback:

Output Zoom

Zoom in to see an enlarged view of any output.

Subscribe to Pro
Learn about all Pro features »

Edit this favorite

AdvertisementAvoid ads Upgrade to Wolfram|Alpha Pro »

CDF Interactivity

Bring Wolfram|Alpha output to life with CDF interactivity.

Subscribe to Pro
Learn about all Pro features »